View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_high_83 (Length: 241)
Name: NF18406_high_83
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_high_83 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 37990490 - 37990696
Alignment:
| Q |
1 |
cttaaaaattattgattgtgattgtgaatgtaaacgagggctttaacatcacgttggatcatcacatcgtactaagaaacgcttgcataagtgatattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37990490 |
cttaaaaattattgattgtgattgtgaatgtaaacaagggctttaacatcacgttggatcatcacatcgtactaagaaacgcttgcataaatgatattag |
37990589 |
T |
|
| Q |
101 |
acattttatctttatctaaaatcttgaagcattgagtttacgagtgatttcatatgttgttcaatctaaactcttttatccaatgtaagatttaactcac |
200 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37990590 |
atattttatcttcatctaaaatcttgaagcattgagtttacgattgatttcatatgttgttcaatctaaactcttttatctaatgtaagatttaactcac |
37990689 |
T |
|
| Q |
201 |
attttac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
37990690 |
attttac |
37990696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University