View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_high_97 (Length: 234)
Name: NF18406_high_97
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_high_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 213
Target Start/End: Original strand, 35202983 - 35203172
Alignment:
| Q |
24 |
aatgaaaggcggtgatccttttcatcatgaggctgggatgatggattcaaaagaagtgaaattaggtgaaggattacaaaacaggttggatcagtggagt |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202983 |
aatgaaaggtggtgatccttttcatcatgaggctgggatgatggattcaaaagaagtgaaattaggtgaaggattacaaaacaggttggatcagtggagt |
35203082 |
T |
|
| Q |
124 |
aataatatgaatgtgcctaatggtggtgttgcttttcaaaaccagatggagaatatgggtttgtcagattcttcttctctttattggaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203083 |
aataatatgaatgtgcctaatggtggtgttgcttttcaaaaccagatggagaatatgggtttgtcagattcttcttctctttattggaat |
35203172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University