View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18406_low_101 (Length: 234)

Name: NF18406_low_101
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18406_low_101
NF18406_low_101
[»] chr4 (1 HSPs)
chr4 (24-213)||(35202983-35203172)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 213
Target Start/End: Original strand, 35202983 - 35203172
Alignment:
24 aatgaaaggcggtgatccttttcatcatgaggctgggatgatggattcaaaagaagtgaaattaggtgaaggattacaaaacaggttggatcagtggagt 123  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202983 aatgaaaggtggtgatccttttcatcatgaggctgggatgatggattcaaaagaagtgaaattaggtgaaggattacaaaacaggttggatcagtggagt 35203082  T
124 aataatatgaatgtgcctaatggtggtgttgcttttcaaaaccagatggagaatatgggtttgtcagattcttcttctctttattggaat 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35203083 aataatatgaatgtgcctaatggtggtgttgcttttcaaaaccagatggagaatatgggtttgtcagattcttcttctctttattggaat 35203172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University