View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_102 (Length: 232)
Name: NF18406_low_102
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_102 |
 |  |
|
| [»] scaffold0651 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 195
Target Start/End: Complemental strand, 31314125 - 31314008
Alignment:
| Q |
77 |
tgaaacaaacaaacttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagata |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
31314125 |
tgaaacaaacaagcttagattttagtcaattgcatatccctttctttcttatcttccgcttcc-agctccccacatttatttcacttaaataattagata |
31314027 |
T |
 |
| Q |
177 |
tcagtctatcagattctcc |
195 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
31314026 |
tcagtctagcagattctcc |
31314008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 195
Target Start/End: Original strand, 31315048 - 31315151
Alignment:
| Q |
91 |
ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagatatcagtctatcagat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31315048 |
ttagattttagtcaattgcatatccctttctttcatatcttccgcttcc-aactccccacatttatttcacttaaataattagatatcagtatatcagat |
31315146 |
T |
 |
| Q |
191 |
tctcc |
195 |
Q |
| |
|
||||| |
|
|
| T |
31315147 |
tctcc |
31315151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0651
Description:
Target: scaffold0651; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 195
Target Start/End: Complemental strand, 8649 - 8546
Alignment:
| Q |
91 |
ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagatatcagtctatcagat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8649 |
ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaa-ctccccacatttatttcacttaaataattagatatcagtatatcagat |
8551 |
T |
 |
| Q |
191 |
tctcc |
195 |
Q |
| |
|
||||| |
|
|
| T |
8550 |
tctcc |
8546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University