View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18406_low_102 (Length: 232)

Name: NF18406_low_102
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18406_low_102
NF18406_low_102
[»] chr4 (2 HSPs)
chr4 (77-195)||(31314008-31314125)
chr4 (91-195)||(31315048-31315151)
[»] scaffold0651 (1 HSPs)
scaffold0651 (91-195)||(8546-8649)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 195
Target Start/End: Complemental strand, 31314125 - 31314008
Alignment:
77 tgaaacaaacaaacttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagata 176  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||    
31314125 tgaaacaaacaagcttagattttagtcaattgcatatccctttctttcttatcttccgcttcc-agctccccacatttatttcacttaaataattagata 31314027  T
177 tcagtctatcagattctcc 195  Q
    |||||||| ||||||||||    
31314026 tcagtctagcagattctcc 31314008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 195
Target Start/End: Original strand, 31315048 - 31315151
Alignment:
91 ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagatatcagtctatcagat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||    
31315048 ttagattttagtcaattgcatatccctttctttcatatcttccgcttcc-aactccccacatttatttcacttaaataattagatatcagtatatcagat 31315146  T
191 tctcc 195  Q
    |||||    
31315147 tctcc 31315151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0651 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0651
Description:

Target: scaffold0651; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 195
Target Start/End: Complemental strand, 8649 - 8546
Alignment:
91 ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaaactccccacatttatttcacttaaataattagatatcagtctatcagat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||    
8649 ttagattttagtcaattgcatatccctttctttcatatcttccgcttccaa-ctccccacatttatttcacttaaataattagatatcagtatatcagat 8551  T
191 tctcc 195  Q
    |||||    
8550 tctcc 8546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University