View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_38 (Length: 364)
Name: NF18406_low_38
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 353
Target Start/End: Complemental strand, 53803010 - 53802673
Alignment:
| Q |
16 |
attttatctttcgttaaggtgttgggtcgttagtccattatagtgtacctttcttacagtcaatgatcgtatgattggcaatatagagattcgtgaaatc |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
53803010 |
attttatctttcgctaaggtgttgggtcgtcagtccattataatgtacctttcttaaagtcaatgatcgtatgattgacaacatagagattcgtgaaatc |
53802911 |
T |
 |
| Q |
116 |
acgttgaaagtctctcaatgacttcaaccaaatttaccctaattcacatgaaaacttgtttataacaaaaccccttcacgagaagaaatttgcacattct |
215 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
53802910 |
acgttgagagtcgctcaatgacttcaaccaaatttaccctaattcacatgaaaacttatttataaaaggaccccttcaccagaagaaatttgcacattct |
53802811 |
T |
 |
| Q |
216 |
atttaaataatattgcattatatttaatcaaatactaactcgagcatcaaaatgtttgcaagtacatcatttctttcgcaaaacttcactattgttcttc |
315 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53802810 |
atttcaataatattgcattatatttaatcaaatactaacttgagcatcaaagtgtttgcaaatacatcatttctttcgcaaaacttcactattgttcttc |
53802711 |
T |
 |
| Q |
316 |
actgaatgtattacttcgattcccacctcttaattctt |
353 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53802710 |
attgaatgtattacttcgattcccacctcttaattctt |
53802673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University