View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18406_low_50 (Length: 335)

Name: NF18406_low_50
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18406_low_50
NF18406_low_50
[»] chr2 (1 HSPs)
chr2 (299-335)||(10446795-10446831)


Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 335
Target Start/End: Complemental strand, 10446831 - 10446795
Alignment:
299 atcttttttcaaacttttgggttccaaatatgaggac 335  Q
    |||||||||||||||||||||||||||||||| ||||    
10446831 atcttttttcaaacttttgggttccaaatatggggac 10446795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University