View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_50 (Length: 335)
Name: NF18406_low_50
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_50 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 335
Target Start/End: Complemental strand, 10446831 - 10446795
Alignment:
| Q |
299 |
atcttttttcaaacttttgggttccaaatatgaggac |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10446831 |
atcttttttcaaacttttgggttccaaatatggggac |
10446795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University