View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_59 (Length: 312)
Name: NF18406_low_59
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 26470984 - 26470765
Alignment:
| Q |
13 |
tgaacttggcatcttcttttttagctaaaaaagtgaagaatatttcaagctttgagataatgtattgtatgtttttagaatcaaagaatgatatgaaaaa |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26470984 |
tgaacttgacatcttcttttttagctaaaaaagtgaagaatatttcaagctttaagataatgtattgtatgtttttagaatcaaagaatgatatgaaaaa |
26470885 |
T |
 |
| Q |
113 |
tttgatgtatctaagaagcatataaatcaagtaacaattatgaagctagtagtgtttgtaacttgtataactgatcaggtgaacctgctatgctcagaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26470884 |
tttgatgtatctaagaagcatataaatcaagtaacaattatgaagctagtagtgtttgtaacttgtataactgatcaggtgaacctgctatgctcagaaa |
26470785 |
T |
 |
| Q |
213 |
gtgccactaacaaatccatt |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26470784 |
gtgccactaacaaatccatt |
26470765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 252 - 297
Target Start/End: Complemental strand, 26470743 - 26470698
Alignment:
| Q |
252 |
ttgttcaaaaagaaccactccaatttaggaaatgagcatgctaatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26470743 |
ttgttcaaaaagaaccactccaatttaggaaatgagcatgctaatt |
26470698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University