View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_63 (Length: 305)
Name: NF18406_low_63
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 77 - 288
Target Start/End: Original strand, 1943721 - 1943932
Alignment:
| Q |
77 |
tgtcacctgaatgcgcataagaagatcatcgctgtgtttgtgggaaaagcgattattacgaaaattttgacgaacggattcgatatcggcgagatcttgt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1943721 |
tgtcacctgaatgcgcataagaagatcatcgctgtgtttgtgggagaagcgattattacgaaaattttgacgaacggattcgatatcggcgagatcttgt |
1943820 |
T |
 |
| Q |
177 |
ggcgatccggagttaggatcgaactcccaaagttgtctaccgacgtgattgtttaatgtacgaagccatggactgcctccttctgcaactttcagtttcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1943821 |
ggcgatccggagttaggatcgaactcccaaagttgtctaccgacgtgattgtttaatgtacgaagccatggactgcctccttctgcaactttcagtttcc |
1943920 |
T |
 |
| Q |
277 |
acatttttcttt |
288 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1943921 |
acatttttcttt |
1943932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University