View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_90 (Length: 240)
Name: NF18406_low_90
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 92 - 223
Target Start/End: Original strand, 308191 - 308322
Alignment:
| Q |
92 |
cattggtgttggatgtttgataattctaaaatattatatgtagtgaaattaatgttttatttcattgagtgcacttgtgtctgctactataagggaattc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
308191 |
cattggtgttggatgtttgataattctaaaatattatatgtagtgaaattaatgttttatttcattgagtgcacttgtgtctgctactataagggaattc |
308290 |
T |
 |
| Q |
192 |
aagtctgtgcactcatatgttatggcaaaagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
308291 |
aagtctgtgcactcatatgttatggcaaaagt |
308322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University