View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18406_low_99 (Length: 234)
Name: NF18406_low_99
Description: NF18406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18406_low_99 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 36371371 - 36371164
Alignment:
| Q |
15 |
cacagagaatgggaacttgtggaaaggatattcctctggagactcaattcatgcttatagagagcaaagatagtgaagaggaagggaaaaattctcccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36371371 |
cacagagaatgggaacttgtggaaaggatattcctctggagactcaattcatgcttatagagagcaaagatagtgaagaggaagggaaaaattctcccat |
36371272 |
T |
|
| Q |
115 |
cgtctacactgtcttgcttcctctattggaaggtccattccgatctgttctacaaggcaatgagaaaagcgagattgagatctgcttcgagagcggtgag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36371271 |
cgtctacactgtcttgcttcctctattggaaggtccattccgatctgttctacaaggcaatgagaaaagcgagattgagatctgcttcgagagcggtgag |
36371172 |
T |
|
| Q |
215 |
taactctt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
36371171 |
taactctt |
36371164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 182
Target Start/End: Complemental strand, 21377704 - 21377558
Alignment:
| Q |
24 |
tgggaacttgtggaaaggatattcctctggagactcaattcatgcttatagagagcaaagatagtgaagaggaagggaaaaattctcccatcgtctacac |
123 |
Q |
| |
|
||||||||||||| | |||||| ||| ||||||| ||||||||||||||||||| |||||| ||| ||||||||||| || | ||||| |
|
|
| T |
21377704 |
tgggaacttgtgggagggatatccctttggagacccaattcatgcttatagagatcaaagaaagt------------aaaaattctccagtcatttacac |
21377617 |
T |
|
| Q |
124 |
tgtcttgcttcctctattggaaggtccattccgatctgttctacaaggcaatgagaaaa |
182 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||||| | || |||||||||||||| |||| |
|
|
| T |
21377616 |
tgtcttacttcctctactggaaggtcaattccgtgcggtcctacaaggcaatgacaaaa |
21377558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University