View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18407_high_8 (Length: 201)

Name: NF18407_high_8
Description: NF18407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18407_high_8
NF18407_high_8
[»] chr6 (1 HSPs)
chr6 (1-182)||(32052202-32052383)


Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 32052202 - 32052383
Alignment:
1 accaggagtggatgcattgagtagttggttaggtgaaattagagcaagtggagtagcactgcgtaatgaagctttcatggttgtggtggcaattggaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32052202 accaggagtggatgcattgagtagttggttaggtgaaattagagcaagtggagtagcactgcgtaatgaagctttcatggttgtggtggcaattggaaat 32052301  T
101 aataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgttttactatgttgat 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32052302 aataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgttttactatgttgat 32052383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University