View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18407_high_8 (Length: 201)
Name: NF18407_high_8
Description: NF18407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18407_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 32052202 - 32052383
Alignment:
| Q |
1 |
accaggagtggatgcattgagtagttggttaggtgaaattagagcaagtggagtagcactgcgtaatgaagctttcatggttgtggtggcaattggaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052202 |
accaggagtggatgcattgagtagttggttaggtgaaattagagcaagtggagtagcactgcgtaatgaagctttcatggttgtggtggcaattggaaat |
32052301 |
T |
 |
| Q |
101 |
aataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgttttactatgttgat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052302 |
aataatggcaagatgtggcacctagttctatactttgggagtgaaataatgtaatgttgtcttgtcgttttactatgttgat |
32052383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University