View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18407_low_5 (Length: 288)
Name: NF18407_low_5
Description: NF18407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18407_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 11401511 - 11401249
Alignment:
| Q |
13 |
gaagaaaaataaataaatatcgactattcgcattgtgaaattaggatttatgtgtttatttgaatttctatttgtgtttcttcaaggtatgggggtatgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401511 |
gaagaaaaataaataaatatcgactattcgcattgtgaaattaggatttatgtgtctatttgaatttctatttgtgtttcttcaaggtatgggggtatgt |
11401412 |
T |
 |
| Q |
113 |
tgtgtgagtgtggatcttaaggattgatgtttgagttctacttgttagattttatgttatgacatagataatttgatcatgtttttacttttactctcca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401411 |
tgtgtgagtgtggatcttaaggattgatgtttgagttctacttgttacattttatgttgtg-catagataatttgatcatgtttttacttttactctcca |
11401313 |
T |
 |
| Q |
213 |
aagtaacattgtgtgcagattaatccttatattaacttttttatataaagtggtgcattgtgtg |
276 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401312 |
aagtatcattgtttgcagattaatccttatattaacttttttatataaagtggtgcattgtgtg |
11401249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University