View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18408_low_11 (Length: 280)
Name: NF18408_low_11
Description: NF18408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18408_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 4 - 279
Target Start/End: Complemental strand, 13203979 - 13203708
Alignment:
| Q |
4 |
agcacagagatgaatgttaggtaggattacttcacttcactgaatgatgaattttcttatattttattccagtaggaaaatctttttgcaagtaagttat |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
13203979 |
agcacaaagatgaatgttaggtaggattacttcacttcactgaatgatgaattttcttatattttattccagtaggaaaatttttttgcaagt----tat |
13203884 |
T |
 |
| Q |
104 |
tgtatattgtatgtattgaatatgttatgcatgtttgaatttatatatgcattctgtagatcaggtcataaatatttggagtcacttctctaagtagaat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13203883 |
tgtatattgtatgtattgaatatgttatgcatgtttgaatttatatatgcattctgtagatcaggtcataaatatttggagtcacttctctaactagaat |
13203784 |
T |
 |
| Q |
204 |
ttcaggagagctctctcttgctttctgcactgccattgattttgtaattgtgaagcacggacactcctcggattag |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13203783 |
ttcaggagagctctctcttgctttctgcactgccattgattttgtaactgtgaagcacggacactcctcggattag |
13203708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University