View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18409_high_12 (Length: 238)
Name: NF18409_high_12
Description: NF18409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18409_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 5570111 - 5569893
Alignment:
| Q |
11 |
gcagcacagaaccagacaaccacccaccaatatctctaatttaggtcatttctctttttccttcnnnnnnn-------atatgtataaatggtagaaatt |
103 |
Q |
| |
|
|||| ||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
5570111 |
gcagaacagaaccagacaaccagcccccaatatctctaatttaggtcatttctctttt-ccttcttttttttttttttatatgtataaatggtagaaatt |
5570013 |
T |
|
| Q |
104 |
taacattttggggactgcggttatcattttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgagcgtttgcagtttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5570012 |
taacattttggggactgcggttatcattttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgatgagcgtttgcagtttg |
5569913 |
T |
|
| Q |
204 |
agttagatttcaatcacaat |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5569912 |
agttagatttcaatcacaat |
5569893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 131 - 223
Target Start/End: Complemental strand, 2498188 - 2498094
Alignment:
| Q |
131 |
tttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgat--gagcgtttgcagtttgagttagatttcaatcacaat |
223 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
2498188 |
tttgtaaaatatgtttattatgtcatcatatgttatgaaaatgttcattttgttgatgagagagtttgcagtttgagttggatttcaatcacaat |
2498094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 131 - 223
Target Start/End: Complemental strand, 27100776 - 27100682
Alignment:
| Q |
131 |
tttgtgaaatatgtttattgtgtcatcatatgttatgaaaatgttcattttgttgat--gagcgtttgcagtttgagttagatttcaatcacaat |
223 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
27100776 |
tttgtaaaatatgtttattatgtcatcatatgttatgaaaatgttcattttgttgatgagagagtttgcagtttgagttggatttcaatcacaat |
27100682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University