View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18409_high_8 (Length: 317)
Name: NF18409_high_8
Description: NF18409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18409_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 14 - 317
Target Start/End: Original strand, 5900834 - 5901137
Alignment:
| Q |
14 |
cagccctaacaaaaacataactaacataaccttatcaagtaaacacaatcacacataacctaaattaaaacaaaatcatcccnnnnnnnntacttttcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5900834 |
cagccctaacaaaaacataactaacatcaccttatcaagtaaacacacccacacataacctaaattaaaacaaaatgatcccaaaaaaaatacttttcaa |
5900933 |
T |
 |
| Q |
114 |
ccctaattaatcaagaaaatgtgttctcaccgagattcgattgaggaactgcagcaggcactccattcgcattggttaacggaatacttttactagcatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5900934 |
ccctaattaatcaagaaaatgtgttctcaccgagattcgcttgaggaactgcagcaggcactccattcgcattggttaacggaatacttttactagcatt |
5901033 |
T |
 |
| Q |
214 |
gtaaacattcataacattctgcacaccattcaagaacatctgaacccggttcttctcttgttccatacaaaccctttcttgatccaacatcactctctgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5901034 |
gtaaacattcataacattctgcacaccattcaagaacatctgaacccggttcttctcttgttccatacaaaccctttcttgatccaacatcactttctgc |
5901133 |
T |
 |
| Q |
314 |
tcct |
317 |
Q |
| |
|
|||| |
|
|
| T |
5901134 |
tcct |
5901137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University