View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_high_32 (Length: 277)
Name: NF18411_high_32
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 50559774 - 50559565
Alignment:
| Q |
15 |
gtgagatgaacaacaattattgcaggaagaaaggccaacaaaatgatccaaaaataagtttaaatatttgttggcacagcaactgaacgcgttttccgtc |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50559774 |
gtgacatgaacaacaattattgcaggaagaaaggccaacaaaatgatccaaaaataagtttaaatatttgttggcacagcaactgaacgcgttttctgtc |
50559675 |
T |
 |
| Q |
115 |
catccatgatttaaaaaatggctgtatcacaaatctgattcaatctacagcctaagctataaatcatttcatttgtgacttgcatttggagcattattac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50559674 |
catccatgatttaaaaaatggctgtatcacaaatctgattcaatctacagcctaagctataaatcatttcatttgtgacttgcatttggagcattatttc |
50559575 |
T |
 |
| Q |
215 |
aataagataa |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
50559574 |
aataagataa |
50559565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University