View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_high_40 (Length: 248)
Name: NF18411_high_40
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 101 - 232
Target Start/End: Complemental strand, 44395405 - 44395274
Alignment:
| Q |
101 |
gaagcatattatttttacaagatcttaatannnnnnngtatattttcgtttcattctccaagtaattgtcgtatgtggttttccctctggccattatagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44395405 |
gaagcatattatttttacaagatcttaatatttttttgtatattgtcgtttcattctccaagtaattgtcgtatgtggttttccctctggccattatagt |
44395306 |
T |
 |
| Q |
201 |
tatttcattgtactgctttctaaccatgtatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44395305 |
tatttcattgtactgctttctaaccatgtatg |
44395274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 44395495 - 44395455
Alignment:
| Q |
9 |
gaaaagaaaagataatggggatcatatagtcttctaacccc |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44395495 |
gaaaagaaaagatactggggatcatatagtcttctaacccc |
44395455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University