View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_high_44 (Length: 230)
Name: NF18411_high_44
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 2410711 - 2410618
Alignment:
| Q |
18 |
agacaccagacacaatagtgacatgtgtccgtgtcagacattcacatatgtgtctgacattggatatgtagtgttgtagatgttttcattttga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2410711 |
agacaccagacacaatagtgacatgtgtccgtgtcagacattcacatatgtgtctcacattggatatgcagtgttgtagatgttttcattttga |
2410618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 148 - 216
Target Start/End: Complemental strand, 2410621 - 2410553
Alignment:
| Q |
148 |
ttgataattggaactcaattctcaggatgtgaccaaaagcatgaagaagagtttgattctgaagcaatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410621 |
ttgataattggaactcaattctcaggatgtgaccaaaagcatgaagaagagtttgattctgaagcaatt |
2410553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University