View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_low_39 (Length: 249)
Name: NF18411_low_39
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 96 - 235
Target Start/End: Original strand, 5526879 - 5527018
Alignment:
| Q |
96 |
tagtgattttagtgcatgttcactagatttgctaaaataatgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526879 |
tagtaattttagtgcatgttcactagatttgctaaaataacgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
5526978 |
T |
 |
| Q |
196 |
taattcattatatttcgttgtttcacattgattatctata |
235 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5526979 |
taattcattagatttcgttgtttcacattcattatctata |
5527018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 5526087 - 5526187
Alignment:
| Q |
1 |
ccatgtcccctcgtaccc--tttggtggtcttgtaatctgaaagttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtag |
98 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526087 |
ccatgtcccctcgtacccccttgggtggtcttgtaatctgaaagttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtag |
5526186 |
T |
 |
| Q |
99 |
t |
99 |
Q |
| |
|
| |
|
|
| T |
5526187 |
t |
5526187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University