View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18411_low_40 (Length: 248)

Name: NF18411_low_40
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18411_low_40
NF18411_low_40
[»] chr1 (2 HSPs)
chr1 (101-232)||(44395274-44395405)
chr1 (9-49)||(44395455-44395495)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 101 - 232
Target Start/End: Complemental strand, 44395405 - 44395274
Alignment:
101 gaagcatattatttttacaagatcttaatannnnnnngtatattttcgtttcattctccaagtaattgtcgtatgtggttttccctctggccattatagt 200  Q
    ||||||||||||||||||||||||||||||       ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44395405 gaagcatattatttttacaagatcttaatatttttttgtatattgtcgtttcattctccaagtaattgtcgtatgtggttttccctctggccattatagt 44395306  T
201 tatttcattgtactgctttctaaccatgtatg 232  Q
    ||||||||||||||||||||||||||||||||    
44395305 tatttcattgtactgctttctaaccatgtatg 44395274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 44395495 - 44395455
Alignment:
9 gaaaagaaaagataatggggatcatatagtcttctaacccc 49  Q
    |||||||||||||| ||||||||||||||||||||||||||    
44395495 gaaaagaaaagatactggggatcatatagtcttctaacccc 44395455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University