View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_low_48 (Length: 214)
Name: NF18411_low_48
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 34772183 - 34772366
Alignment:
| Q |
13 |
agatgaaaagttagtttggagggaccgtggagcaagaaattgctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772183 |
agatgaaaagttagtttggagggaccgtggagcaagaaattgctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaa |
34772282 |
T |
 |
| Q |
113 |
gaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagagagccaaactgagagccgccgctgctactgctagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772283 |
gaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagagagccaaactgagagccgccgctgctactgctagt |
34772366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 63 - 164
Target Start/End: Complemental strand, 9531926 - 9531826
Alignment:
| Q |
63 |
caagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagag |
162 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||| | ||| |||||||||||||||||||| |||||||||||| || ||||||| ||||||||| |
|
|
| T |
9531926 |
caagacgtcatggatgggatgttctaggatggacatcag-agagatgaaagaaatgtattgcaggctttctaatgcaatttcagttgctagcgaagagag |
9531828 |
T |
 |
| Q |
163 |
ag |
164 |
Q |
| |
|
|| |
|
|
| T |
9531827 |
ag |
9531826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University