View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18411_low_48 (Length: 214)

Name: NF18411_low_48
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18411_low_48
NF18411_low_48
[»] chr6 (1 HSPs)
chr6 (13-196)||(34772183-34772366)
[»] chr5 (1 HSPs)
chr5 (63-164)||(9531826-9531926)


Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 34772183 - 34772366
Alignment:
Q  13 agatgaaaagttagtttggagggaccgtggagcaagaaattgctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34772183 agatgaaaagttagtttggagggaccgtggagcaagaaattgctttgaagcaagacttcatggatgggatgctctaggtacgacatccggagacatgaaa 34772282  T
Q  113 gaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagagagccaaactgagagccgccgctgctactgctagt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34772283 gaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagagagccaaactgagagccgccgctgctactgctagt 34772366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 63 - 164
Target Start/End: Complemental strand, 9531926 - 9531826
Alignment:
Q  63 caagacttcatggatgggatgctctaggtacgacatccggagacatgaaagaaatgtattgcagactttctaatgcagttgatgttgctaacgaagagag 162  Q
    |||||| |||||||||||||| ||||||   |||||| | ||| |||||||||||||||||||| |||||||||||| ||   ||||||| |||||||||    
T  9531926 caagacgtcatggatgggatgttctaggatggacatcag-agagatgaaagaaatgtattgcaggctttctaatgcaatttcagttgctagcgaagagag 9531828  T
Q  163 ag 164  Q
    ||    
T  9531827 ag 9531826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University