View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18411_low_51 (Length: 205)

Name: NF18411_low_51
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18411_low_51
NF18411_low_51
[»] chr8 (1 HSPs)
chr8 (12-183)||(29115813-29115984)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 29115813 - 29115984
Alignment:
12 gagaagaacgcgattctaattgcttctataattaacgagaaaagtgagagaattttaaactggagatttaggcatcatgaagtgaaaccaagtgtataat 111  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |     
29115813 gagatgaacgcgattctaattgcttctataattaacgagaaaagtgagagaattttaaactggagatttaggcagcatgaagtgaaaccaagtgtatga- 29115911  T
112 taagttacggtttattaaactagaaatgatacacat---ggatggttttgtagaattaaaattgagtaacaagtt 183  Q
     |||||||||||||||||||||||||| ||| ||||   ||||||||||||||||||||||||||||||||||||    
29115912 -aagttacggtttattaaactagaaat-ataaacatgcaggatggttttgtagaattaaaattgagtaacaagtt 29115984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University