View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18411_low_52 (Length: 205)
Name: NF18411_low_52
Description: NF18411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18411_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 5601842 - 5602013
Alignment:
| Q |
16 |
gcaaaggggccactcatgggatcacaaggggaagatgggtggtgacttgtgagtgcagtttgatggaatatattgaatgtatgtgtaccatgtccatgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5601842 |
gcaaaggggccactcatgggatcacaaggggaagatgggtggtgacttgtgagtgcagtttgatggaatatattgaatgtatgtgtaccatgtccatgtg |
5601941 |
T |
 |
| Q |
116 |
cctacctatatagactttagagttggagcgtgacnnnnnnnttgattagtaggccataactgcaatacatttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5601942 |
cctacctatatagactttagagttggagcgtgac-aaaaaattgattagtaggccataactgcaatacatttt |
5602013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University