View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18412_high_1 (Length: 835)

Name: NF18412_high_1
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18412_high_1
NF18412_high_1
[»] chr1 (1 HSPs)
chr1 (125-181)||(27778745-27778801)
[»] chr6 (1 HSPs)
chr6 (174-214)||(20742683-20742723)
[»] chr4 (1 HSPs)
chr4 (173-213)||(5361683-5361723)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 125 - 181
Target Start/End: Original strand, 27778745 - 27778801
Alignment:
125 aatcatagaagtttgacaatattttttacatccatgtggaaaagtttcaattatatt 181  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
27778745 aatcataaaagtttgacaatattttttacatccatgtggaaaagtttcaattatatt 27778801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 20742683 - 20742723
Alignment:
174 attatattgtcaaactaacaagtcttgcaaacatgtgaaat 214  Q
    |||||||||||||||||||||||||||||||| ||||||||    
20742683 attatattgtcaaactaacaagtcttgcaaacttgtgaaat 20742723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 5361683 - 5361723
Alignment:
173 aattatattgtcaaactaacaagtcttgcaaacatgtgaaa 213  Q
    ||||||||||||||| |||||||||||||||||||||||||    
5361683 aattatattgtcaaattaacaagtcttgcaaacatgtgaaa 5361723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University