View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_high_44 (Length: 260)
Name: NF18412_high_44
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 3603614 - 3603793
Alignment:
| Q |
1 |
tatgcttttgttgccatatttggatcatattattagatgcttttttgagggtcaacgtagtagatgctagttagacacttatcctggctgtaaaattcca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3603614 |
tatgcttttgttgccatatttggaccatattattagatgctttt-tgagggtcaacgtagtagatgctagttagacacttttcctggctgtaaaattcca |
3603712 |
T |
 |
| Q |
101 |
tgttccttgttctacaattatacattattaggcaaaacctcgatattagaattcggattgataaacttctactatgaacca |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3603713 |
cgttccttgttctacaattatacatcattaggcaaaacctcgatattagaattcggattgataaacttctactatgaacca |
3603793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 247
Target Start/End: Original strand, 3603847 - 3603882
Alignment:
| Q |
212 |
tatcggaatgtgacatacgaaatttttggtttccct |
247 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3603847 |
tatcagaatgtgacatacgaaatttttggtttccct |
3603882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University