View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_high_49 (Length: 252)
Name: NF18412_high_49
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_high_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 27 - 236
Target Start/End: Complemental strand, 38699751 - 38699542
Alignment:
| Q |
27 |
tccttggacgacagataaatttgttatatatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38699751 |
tccttggacgacagataaatttgttatatatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaata |
38699652 |
T |
|
| Q |
127 |
ttttcttcattcgatgttggagaaggacctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttactt |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699651 |
ttttcttcaatcgatgttggagaaggacctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttactt |
38699552 |
T |
|
| Q |
227 |
atgatttcat |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
38699551 |
atgatttcat |
38699542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University