View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18412_high_53 (Length: 245)

Name: NF18412_high_53
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18412_high_53
NF18412_high_53
[»] chr4 (1 HSPs)
chr4 (1-195)||(30684113-30684309)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 30684309 - 30684113
Alignment:
1 ttcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaac-tagtcacacacgttaaatcct 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||    
30684309 ttcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaacttagtcacacaagttaaatcct 30684210  T
100 t-ttttagcattgtcatatgtgatgtgacattcccactacaatgtcatgcacgtgagatccgacatcgagtaagtgagttagcgaaaagctatgaag 195  Q
    | ||| ||||||| |||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
30684209 tctttgagcattgacatatgtgatctgacattcccaccacaatgtcatgcacgtgggatccgacatcgagtaagtgagttagcgaaaagctatgaag 30684113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University