View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_38 (Length: 304)
Name: NF18412_low_38
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 48533752 - 48533648
Alignment:
| Q |
129 |
acaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533752 |
acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
48533653 |
T |
|
| Q |
229 |
agtga |
233 |
Q |
| |
|
||||| |
|
|
| T |
48533652 |
agtga |
48533648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 46 - 210
Target Start/End: Complemental strand, 48536811 - 48536647
Alignment:
| Q |
46 |
gatcacaaaccaaacaatgtctccgtcgcaagctgcaggaacacgtcgtggctcaacatggactatcaatattaaaattgaacacaagtttactctagag |
145 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||| | |||||||| | |||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
48536811 |
gatcataaaccaaacaatgtctgcgtcccaagctgcaggaacagggggtggctcagcgctgactatcaatatcaaagttgaacacaagtttacggtagag |
48536712 |
T |
|
| Q |
146 |
ttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga |
210 |
Q |
| |
|
||| |||||| || ||||| ||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
48536711 |
ttggcggatctggtgaccgttgtcgctgcagattcgacgaaagcgccgagcatcgatgttgagga |
48536647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 12 - 62
Target Start/End: Complemental strand, 48533799 - 48533749
Alignment:
| Q |
12 |
atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533799 |
atgaatgaatcttgacgcaaacaaaccctgttttgatcacaaaccaaacaa |
48533749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University