View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_43 (Length: 263)
Name: NF18412_low_43
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 128 - 244
Target Start/End: Original strand, 15454728 - 15454844
Alignment:
| Q |
128 |
atggttgtttgttaaggtttttaatgtcaaattaaagccacctatgaaattaagaaagatgtatgtaccttgaaatcatccatttcagaaggtgaaactg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454728 |
atggttgtttgttaaggtttttaatgtcaaattaaagccacctatgaaattaagaaagatgtatgtaccttgaaatcatccatttcagaaggtgaaactg |
15454827 |
T |
|
| Q |
228 |
gtggactatctgttaaa |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15454828 |
gtggactatctgttaaa |
15454844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 15454611 - 15454687
Alignment:
| Q |
11 |
cagagaaagctgaaattggtactagtggtttctaactgtacactgtacagtgagatcagtgtttcgtgctttgtacc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454611 |
cagagaaagctgaaattggtactagtggtttctaactgtacactgtacagtgagatcagtgtttcgtgctttgtacc |
15454687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University