View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_52 (Length: 247)
Name: NF18412_low_52
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 43989312 - 43989525
Alignment:
| Q |
14 |
gagagaagaagcgacaaagaaggagtggacggcgcagacatagtgaccatggacagtggcgaaagagaacgaattgaacagagaagaagaataaggaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43989312 |
gagagaagaagcgacaaagaaggagtggacggcgcagacacagtgaccatggacagtggcgaaagagaacgaattgaacagagaagaagaataaggaaaa |
43989411 |
T |
 |
| Q |
114 |
ggtgtgggacgacatgatcgtaagtcaaagaaggagaacaaggcaaccgaggacaatatgacaatgggctctaaaacatgaggaattcnnnnnnngctga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43989412 |
ggtgtgggacgacatgatcgtaagtcaaagaaggagaacaaggcaaccgaggacaatatgacaatgggctctaaaacatgaggaattctttttttgctga |
43989511 |
T |
 |
| Q |
214 |
gacacgggttactt |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43989512 |
gacacgggttactt |
43989525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 96 - 158
Target Start/End: Complemental strand, 43918590 - 43918528
Alignment:
| Q |
96 |
gaagaagaataaggaaaaggtgtgggacgacatgatcgtaagtcaaagaaggagaacaaggca |
158 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||| ||| ||||||| |||||| |
|
|
| T |
43918590 |
gaagaagaataaggagaaggcatgggacgacatgatcgtaggtcgaaggaggagaagaaggca |
43918528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University