View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_54 (Length: 245)
Name: NF18412_low_54
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 30684309 - 30684113
Alignment:
| Q |
1 |
ttcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaac-tagtcacacacgttaaatcct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30684309 |
ttcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaacttagtcacacaagttaaatcct |
30684210 |
T |
 |
| Q |
100 |
t-ttttagcattgtcatatgtgatgtgacattcccactacaatgtcatgcacgtgagatccgacatcgagtaagtgagttagcgaaaagctatgaag |
195 |
Q |
| |
|
| ||| ||||||| |||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30684209 |
tctttgagcattgacatatgtgatctgacattcccaccacaatgtcatgcacgtgggatccgacatcgagtaagtgagttagcgaaaagctatgaag |
30684113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University