View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_55 (Length: 243)
Name: NF18412_low_55
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 3543717 - 3543484
Alignment:
| Q |
1 |
tcatagcaaagaaagtattatatatcgcatatttgatacaattatcgacggcacggttttccacaaatggtgataataaagtaagaaacaaaacatacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543717 |
tcatagcaaagaaagtattatatatcgcatatttgatacaattatcgacggcacagttttccacaaatggtgataataaagtaagaaacaaaacatacta |
3543618 |
T |
 |
| Q |
101 |
tccacactaaactgtaatgtatttgagaacagccccacggagcttctccatgtattctgcagcttgcttctgcaacaaggaaaataagcactaatctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543617 |
tccacactaaactgtaatgtatttgagaacagccccacggagcttctccatgtattctgcagcttgcttctgcaacaaggaaaataagcactaatctcaa |
3543518 |
T |
 |
| Q |
201 |
tatcaccaataaagtatgtgcaccacaggttctg |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
3543517 |
tatcaccaataaagtatgtgcaccacaagttctg |
3543484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 2220631 - 2220581
Alignment:
| Q |
153 |
tattctgcagcttgcttctgcaacaaggaaaataagcactaatctcaatat |
203 |
Q |
| |
|
|||| ||||| |||||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
2220631 |
tattttgcagtttgcttttacaacaaggaaaataatcactaatctcaatat |
2220581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University