View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_59 (Length: 235)
Name: NF18412_low_59
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_59 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 37067380 - 37067611
Alignment:
| Q |
12 |
caagtaatacaataaatagatggatagaatacaaggtgaattgattaannnnnnnnnn--------acaagatacaaagtgaattgatgatgcggtaact |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
37067380 |
caagtaatacaataaatagatggatagaatacaaggtgaattgattaattgattaattttttttttacaagatacaaagtgaattgatgatgcggttact |
37067479 |
T |
|
| Q |
104 |
ttacactatggtgatatatgtcgcgaacaactttctcgggacaaataacattaatcaagcnnnnnnnntacacctcgctagatacatatccattttttac |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37067480 |
ttaccctatggtgatatatgtcgcgaacaactttctcgggacaaataacattaatcaagcaaaaaaaatacacctcgctagatacatatccattttttac |
37067579 |
T |
|
| Q |
204 |
ttatatgtttttaaaaagttttgcttttacct |
235 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
37067580 |
ttatatttttttaaaaagttttgcttttacct |
37067611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University