View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18412_low_60 (Length: 232)
Name: NF18412_low_60
Description: NF18412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18412_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 31 - 214
Target Start/End: Original strand, 3543697 - 3543874
Alignment:
| Q |
31 |
ataatactttctttgctatgatatcatagtaaatgagttgtaaattttgaaatactagtatgtatgactaatgtatcgttagttggaaatcttgtaaaat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3543697 |
ataatactttctttgctatgatatcatagtaaatgagttgtaaattttgaaatac------gtatgactaatgtatctttagttggaaatcttgtaaaat |
3543790 |
T |
 |
| Q |
131 |
tgtttttaaaatcacaatatacacatcctgttaattgagaatttggttctatttttgagtgatttcaatttttctccttgatga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
3543791 |
tgtttttaaaatcacaatatacacatcctgttaattgagaatttggttctgtttttgagtgatttcaatttttctccttcatga |
3543874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University