View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18413_high_10 (Length: 334)
Name: NF18413_high_10
Description: NF18413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18413_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 41 - 185
Target Start/End: Original strand, 15695600 - 15695743
Alignment:
| Q |
41 |
aagtagttttgccatggtgatggtaaccgtcgtgtacggaggaggaagaagatgaggtttacgagatttcagggttttggttttggaattgtgaaaaaat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695600 |
aagtagttttgccatggtgatggtaaccgtcgtgtacggaggaggaagaagatgaggtttacgagatttcagggttttggttttggaattgtgaaaaaat |
15695699 |
T |
|
| Q |
141 |
gtggcgatgaaaaatttatctttaaatgaaacataaggtttgtcc |
185 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
15695700 |
gtggcgatgataaatttat-tttaaacgaaacataaggtttgtcc |
15695743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 188 - 317
Target Start/End: Original strand, 15696871 - 15696999
Alignment:
| Q |
188 |
agataaaaagacaccataaatacgattaatctctcgaatcagataacatctttaaactaaaatgttagttaagttggatattcgaactattacatttata |
287 |
Q |
| |
|
||||||||||||| | | ||||| |||||||||||| |||||||||||||||||| || |||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
15696871 |
agataaaaagacatcgtggatacggttaatctctcgagtcagataacatctttaaattaggatgttagttaagttggatattcaaactattgcatttata |
15696970 |
T |
|
| Q |
288 |
caattaatagttgattttgaccatcaattt |
317 |
Q |
| |
|
||| ||||| |||||||||||||||||||| |
|
|
| T |
15696971 |
caa-taataattgattttgaccatcaattt |
15696999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University