View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18413_low_10 (Length: 334)

Name: NF18413_low_10
Description: NF18413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18413_low_10
NF18413_low_10
[»] chr1 (2 HSPs)
chr1 (41-185)||(15695600-15695743)
chr1 (188-317)||(15696871-15696999)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 41 - 185
Target Start/End: Original strand, 15695600 - 15695743
Alignment:
41 aagtagttttgccatggtgatggtaaccgtcgtgtacggaggaggaagaagatgaggtttacgagatttcagggttttggttttggaattgtgaaaaaat 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15695600 aagtagttttgccatggtgatggtaaccgtcgtgtacggaggaggaagaagatgaggtttacgagatttcagggttttggttttggaattgtgaaaaaat 15695699  T
141 gtggcgatgaaaaatttatctttaaatgaaacataaggtttgtcc 185  Q
    |||||||||| |||||||| |||||| ||||||||||||||||||    
15695700 gtggcgatgataaatttat-tttaaacgaaacataaggtttgtcc 15695743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 188 - 317
Target Start/End: Original strand, 15696871 - 15696999
Alignment:
188 agataaaaagacaccataaatacgattaatctctcgaatcagataacatctttaaactaaaatgttagttaagttggatattcgaactattacatttata 287  Q
    ||||||||||||| | |  ||||| |||||||||||| |||||||||||||||||| ||  |||||||||||||||||||||| ||||||| ||||||||    
15696871 agataaaaagacatcgtggatacggttaatctctcgagtcagataacatctttaaattaggatgttagttaagttggatattcaaactattgcatttata 15696970  T
288 caattaatagttgattttgaccatcaattt 317  Q
    ||| ||||| ||||||||||||||||||||    
15696971 caa-taataattgattttgaccatcaattt 15696999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University