View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18413_low_18 (Length: 249)
Name: NF18413_low_18
Description: NF18413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18413_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 52135645 - 52135756
Alignment:
| Q |
124 |
ggatcatagttcttggattttgatgatgatgttgaattcacagaaaagcttttttccaggtatagattttttcttataatttcaacatcttttaacaaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52135645 |
ggatcatagttcttggattttgatgatgatgttgaattcacagaaaagcttttttccaggtatagattttttcttataatttcaacatcttttaacaaat |
52135744 |
T |
 |
| Q |
224 |
cttcttcaccat |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
52135745 |
attcttcaccat |
52135756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 52135522 - 52135580
Alignment:
| Q |
1 |
tgaagagaaaaacaacatttgaatttcttattctttgaaagggaaagtgccctcaatgg |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52135522 |
tgaagagaaaaacaaaatttgaatttcttattctttgaaagggaaagtgccctcaatgg |
52135580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University