View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18413_low_21 (Length: 234)
Name: NF18413_low_21
Description: NF18413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18413_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 41097553 - 41097358
Alignment:
| Q |
13 |
atgaaaagaattttacattttccaacccaagaaccttttgcaaatattttcaacaagttgttgccaaaaggataaataccgaggactccgccaataggga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41097553 |
atgaaaagaattttacattttccaacccaagaaccttttgcaaatattttcaataagttgttgccaaaaggataaatactgaggactccgccaataggga |
41097454 |
T |
 |
| Q |
113 |
ggccaaataaacgaaaagaagctaaccaattttacggtgcaacacaaccaccaccacttccaccaaccaagatatagaaacatcatttccttcaaaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41097453 |
ggccaaataaacgaaaagaagctaaccaattttacggtgcaacacaacca---ccacttccaccaaccaagatatagaaatatcatttccttcaaaaaa |
41097358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University