View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18413_low_8 (Length: 337)
Name: NF18413_low_8
Description: NF18413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18413_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 34672672 - 34672394
Alignment:
| Q |
1 |
tagaagactcagaaagccaaattttggcggcgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagcagattgtgaaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672672 |
tagaagactcagaaagccaaattttggcggtgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagcagattgtgaaatgaa |
34672573 |
T |
|
| Q |
101 |
ggaagggaagattcgagaagcttcttggcagagagagacgaaatgttgtggttccgcggccgtggtgcatggtggagtggcggcggcatcgttgggaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672572 |
ggaagggaagattcgagaagcttcttggcagagagagacgaaatgttgtggttccgcggccgtggtgcatggtggagtggcggcggcatcgttgggaatt |
34672473 |
T |
|
| Q |
201 |
gacgacgatgatgataaccttaattgcttcttgttgctgctactatgatttgtactcaaagaaggcatggttgagagtg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672472 |
gacgacgatgatgataaacttaattgcttcttgttgctgctactatgatttgtactcaaagaaggcatggttgagagtg |
34672394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 3 - 121
Target Start/End: Original strand, 34791048 - 34791166
Alignment:
| Q |
3 |
gaagactcagaaagccaaattttggcggcgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagcagattgtgaaatgaagg |
102 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |||| |||||||| ||| | ||||| | |||| ||| || ||||||||||| | |
|
|
| T |
34791048 |
gaagattcagagagccaaattttggcggcgcctttggaaagagaatcggcggattcaacgtcggtaatttcagcaacgagagctgaatgtgaaatgaaag |
34791147 |
T |
|
| Q |
103 |
aagggaagattcgagaagc |
121 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34791148 |
aagggaagattcgagaagc |
34791166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University