View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_16 (Length: 364)
Name: NF18415_high_16
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 3855071 - 3854900
Alignment:
| Q |
19 |
agtacagacaactcagtttttcaatttaactcgtgtggagcttagctttgagaaaagaggatgaggaatattattatcattatcgttgggattggttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
3855071 |
agtacagacaactcagtttttcaatttaactcatgtggagcttagctttgagaaa-gaggatgaggaatattattgtc------gttgggattggttgaa |
3854979 |
T |
|
| Q |
119 |
gaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattaacaacaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3854978 |
gaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattagcaacaac |
3854900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 276 - 354
Target Start/End: Complemental strand, 3854833 - 3854755
Alignment:
| Q |
276 |
ggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
354 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaatttgtccccaactgcaatgtctttg |
3854755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 29 - 189
Target Start/End: Original strand, 4141580 - 4141730
Alignment:
| Q |
29 |
actcagtttttcaatttaactcgtgtggagcttagctttgagaaaagaggatgaggaatattattatcattatcgttgggattggttgaagaagttcatc |
128 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
4141580 |
actcagtttttcaatttaactcatatggagcttagctttgagaag-gaggatgaggaatattatcat---------tgggattggttgaagaaattcatc |
4141669 |
T |
|
| Q |
129 |
cgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatatta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4141670 |
cgcgcctgcccctctcttcaaagtattgtgattcataaggtttgttaactctatcatatta |
4141730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 271 - 354
Target Start/End: Original strand, 4141819 - 4141902
Alignment:
| Q |
271 |
tcggaggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
354 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4141819 |
tcggaggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaatttgtccccaactgcaatgcctttg |
4141902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University