View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18415_high_24 (Length: 315)

Name: NF18415_high_24
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18415_high_24
NF18415_high_24
[»] chr5 (1 HSPs)
chr5 (33-271)||(43366671-43366909)


Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 33 - 271
Target Start/End: Original strand, 43366671 - 43366909
Alignment:
33 aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43366671 aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa 43366770  T
133 gttacacacagcagcagaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat 232  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43366771 gttacacacagcagcaaaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat 43366870  T
233 gaaaagaaggagaaggcagacggagatggcggaaatgag 271  Q
    |||||||| |||||||||||||||||||| |||||||||    
43366871 gaaaagaaagagaaggcagacggagatggaggaaatgag 43366909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University