View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18415_high_29 (Length: 300)

Name: NF18415_high_29
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18415_high_29
NF18415_high_29
[»] chr3 (2 HSPs)
chr3 (10-131)||(32581859-32581980)
chr3 (200-284)||(32582050-32582134)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 32581859 - 32581980
Alignment:
10 cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaactgcgatgcgctctcgcgtttctcac 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
32581859 cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaaatgcgatgcgctctcgcgtttctcac 32581958  T
110 ttcaagcaacaagccgagtttg 131  Q
    ||||||||||||||||||||||    
32581959 ttcaagcaacaagccgagtttg 32581980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 200 - 284
Target Start/End: Original strand, 32582050 - 32582134
Alignment:
200 gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttg 284  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32582050 gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttg 32582134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University