View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_34 (Length: 270)
Name: NF18415_high_34
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 33 - 260
Target Start/End: Complemental strand, 3036387 - 3036159
Alignment:
| Q |
33 |
ttgactatagttaa-taatttatctattaattataaaagaatgttgtcgttttgttaactgcatggtgttttctttgttcttatataggtgggaagtcgt |
131 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036387 |
ttgactatagttaaataatttatctatgaattataaaagaatgttgtcgttttgttaactgcatggtgttttctttgttcttatataggtgggaagtcgt |
3036288 |
T |
 |
| Q |
132 |
tgaaggtggtgaaacaaaaacggcacgagacgttagaaaacacgtggaagacaataacggagggtcggtcaattccgttaagtagacacatgaagaagtg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036287 |
tgaaggtggtgaaacaaaaacggcacgagacgttagaaaacacgtggaagacaataacggagggtcggtcaattccgttaagtagacacatgaagaagtg |
3036188 |
T |
 |
| Q |
232 |
tgacacgtggcaaaaccgttatgatgatg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3036187 |
tgacacgtggcaaaaccgttatgatgatg |
3036159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University