View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_35 (Length: 270)
Name: NF18415_high_35
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 254
Target Start/End: Complemental strand, 22758493 - 22758245
Alignment:
| Q |
7 |
actccatccagttgtgagcaagtgtcgacgtggttgacctgaatagaaaggacagtcttagaatttggtctgagcctgactcgaccctacaaaaccgact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22758493 |
actccatccagttgtgagcaagtgtcgacgtggttgacctgaatagaaaggaaagtcttagaatttggtctgagcctgactcgaccctacaaaaccgact |
22758394 |
T |
 |
| Q |
107 |
tataaggtaagggatgtctcttatcccactataaacaaattttcaggccttatctaatgtggg-cttcttgacaaaaacacattcaagagaaaacattag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22758393 |
tataaggtaagggatgtctcttatcccactataaacaaattttcaggccttatctaatgtgggacttcttgacaaaaacacattcaagagaaaacattag |
22758294 |
T |
 |
| Q |
206 |
gccactagaagtggtttaacaaaaagacgagtgaaaacttttgatgtca |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22758293 |
gccactagaagtggtttaacaaaaagacgagtgaaaacttttgatgtca |
22758245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University