View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_36 (Length: 266)
Name: NF18415_high_36
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 24946823 - 24946600
Alignment:
| Q |
1 |
tagactatattaaaacacttgatagttatcgacctttggtcttttttcctaatttgacttttcatccatattcgaatgaccctattcccatcagaacttt |
100 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| ||||| |
|
|
| T |
24946823 |
tagactatattaaaacacttgttagtaatcgacctttggtcttttttcctaatttgacttttcattcatatttgaatggccctattcccatcataacttg |
24946724 |
T |
|
| Q |
101 |
tttcaaa-ccctggtttctgtctttgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatatgaatt |
199 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24946723 |
tttcaaaaccctggtttctgtctctgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatattaatc |
24946624 |
T |
|
| Q |
200 |
ggaattgaatgttctgatttgaaa |
223 |
Q |
| |
|
||||||| |||| ||||||||||| |
|
|
| T |
24946623 |
ggaattggatgtcctgatttgaaa |
24946600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University