View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_41 (Length: 243)
Name: NF18415_high_41
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 37844653 - 37844441
Alignment:
| Q |
13 |
cataggttacttttggaacattcagagcagctaccttcacaagcttttcagctattatcttaccatttcccatcagtttaactaaaagtccatcaataca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37844653 |
cataggttacttttggaacattcagagcagctaccttcacaagcttttcagctattatcttaccatttcccatcagtttaactaaaagcccatcaataca |
37844554 |
T |
 |
| Q |
113 |
aattgttggtttgagattccaatcatcttcaacaccgaatccagatagaaattgatcaacgtcatgccaaaagctagagtcactataataatccataggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844553 |
aattgttggtttgagattccaatcatcttcaacaccgaatccagatagaaattgatcaatgtcatgccaaaagctagagtcactataataatccataggt |
37844454 |
T |
 |
| Q |
213 |
tcatgttcagtgt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37844453 |
tcatgttcagtgt |
37844441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University