View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_50 (Length: 224)
Name: NF18415_high_50
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 48167445 - 48167648
Alignment:
| Q |
1 |
aagttgtcaatatttccaacaaacatattacctgacaatggtatgtttttgtgagcttccataggtagatgtttttacgacacagcaaaaatataaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48167445 |
aagttgtcaatatttccaacaaacatattacccgacaatggtatgtttttgggagcttccataggaagatgtttttacgacacagcaaaaatataaatct |
48167544 |
T |
|
| Q |
101 |
tctgcacgaacttgtattttcgatacggttcttaaaatttgggtttggtatttcagcaacagtatcttatttgtgctcaagtatgcatgactatagaatt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
48167545 |
tctgcacaaacttgtattttcgatacggttcttaaaatttgggtttggtatttcagcaacagtatcttatttgcgct-aagtatgcatgactatagaatt |
48167643 |
T |
|
| Q |
201 |
acatt |
205 |
Q |
| |
|
||||| |
|
|
| T |
48167644 |
acatt |
48167648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University