View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_51 (Length: 224)
Name: NF18415_high_51
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 42869552 - 42869740
Alignment:
| Q |
7 |
agtgagaagaagaagagattgtcgccaactacaaaggatagaagaggttcctacaaaagaaggtactgtttgttttgtacggacacaaggaaaaaacatg |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42869552 |
agtgagagtaagaagagattgtcgccaactacaaaggatagaagaggttcctacaaaagaaggtactgtttgttttgtacggacacaaggaaaaaacatg |
42869651 |
T |
|
| Q |
107 |
nnnnnnnnnnnnnngcactgttctcacacatcatcacatgataagaagaaattactaatctttattgttaattattatgcaggaagacagatgagacaag |
206 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42869652 |
----ttttttttttgcactattctca--------cacatgataagaagaaattactaatctttattgttaattattatgcaggaagacagatgagacaag |
42869739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University