View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_high_54 (Length: 218)
Name: NF18415_high_54
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 134
Target Start/End: Original strand, 3036564 - 3036683
Alignment:
| Q |
15 |
tgataccttctggaccgaatttaagaggtttccggtgagggaacctagtagaaaggagaggtttatcaaccggcgagtccatcctcttcagcggaaaaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3036564 |
tgataccttctggaccgaatttaagaggtttccggtgagtgaacctagtagaaaggagaggtttatcaaccggcgagtccatcctcttcagtggaaaaat |
3036663 |
T |
 |
| Q |
115 |
tccaacgtcaatttgtttgg |
134 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3036664 |
tccaacgtcaatttgtttgg |
3036683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 3036702 - 3036742
Alignment:
| Q |
156 |
ttggcggtggttgcaaaattccgaggtctatttgtttaata |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036702 |
ttggcggtggttgcaaaattccgaggtctatttgtttaata |
3036742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University