View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_low_32 (Length: 300)
Name: NF18415_low_32
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 32581859 - 32581980
Alignment:
| Q |
10 |
cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaactgcgatgcgctctcgcgtttctcac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32581859 |
cagagagaacatggcagaagatggaacgaagaagatgaatgacgatgtcgacgtggttcagtctcagattgaaaatgcgatgcgctctcgcgtttctcac |
32581958 |
T |
|
| Q |
110 |
ttcaagcaacaagccgagtttg |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32581959 |
ttcaagcaacaagccgagtttg |
32581980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 200 - 284
Target Start/End: Original strand, 32582050 - 32582134
Alignment:
| Q |
200 |
gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582050 |
gtttaattttcaatgcagttctttgacatttgcaagtgttcgtagattgctcgagaaagatttagggtttgacgagttttctttg |
32582134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University